Structure of the DNA repair helicase HEL308 reveals DNA binding and autoinhibitory domains.

J Biol Chem. 2007 Dec 4;

Authors: Richards JD, Johnson KA, Liu H, McRobbie AM, McMahon S, Oke M, Carter L, Naismith JH, White MF

Hel308 is a superfamily 2 helicase conserved in eukaryotes and archaea. It is thought to function in the early stages of recombination following replication fork arrest, and has a specificity for removal of the lagging strand in model replication forks. A homologous helicase constitutes the N-terminal domain of human DNA polymerase Q. The Drosophila homologue mus301 is implicated in double strand break repair and meiotic recombination. We have solved the high-resolution crystal structure of Hel308 from the crenarchaeon Sulfolobus solfataricus, revealing a five-domain structure with a central pore lined with essential DNA binding residues. The fifth domain is shown to act as an autoinhibitory domain or molecular brake, clamping the ssDNA extruded through the central pore of the helicase structure to limit the enzyme's helicase activity. This provides an elegant mechanism to tune the enzyme's processivity to its functional role. Hel308 can displace streptavidin from a biotinylated DNA molecule, and this activity is only partially inhibited when the DNA is pre-bound with abundant DNA binding proteins RPA or Alba1, whilst pre-binding with the recombinase RadA has no effect on activity. These data suggest that one function of the enzyme may be in the removal of bound proteins at stalled replication forks and recombination intermediates.

PMID: 18056710 [PubMed - as supplied by publisher]

Overlapping activator sequences determined for two oppositely oriented promoters in halophilic Archaea.

Nucleic Acids Res. 2007 Dec 1;

Authors: Bauer M, Marschaus L, Reuff M, Besche V, Sartorius-Neef S, Pfeifer F

Transcription of the genomic region involved in gas vesicle formation in Halobacterium salinarum (p-vac) and Haloferax mediterranei (mc-vac) is driven by two divergent promoters, P(A) and P(D), separated by only 35 nt. Both promoters are activated by the transcription activator GvpE which in the case of P(mcA) requires a 20-nt sequence (UAS) consisting of two conserved 8-nt sequence portions located upstream of BRE. Here, we determined the two UAS elements in the promoter region of p-vac by scanning mutageneses using constructs containing P(pD) (without P(pA)) fused to the bgaH reporter gene encoding an enzyme with beta-galactosidase activity, or the dual reporter construct pApD with P(pD) fused to bgaH and P(pA) to an altered version of gvpA. The two UAS elements found exhibited a similar extension and distance to BRE as previously determined for the UAS in P(mcA). Their distal 8-nt portions almost completely overlapped in the centre of P(pD)-P(pA), and mutations in this region negatively affected the GvpE-mediated activation of both promoters. Any alteration of the distance between BRE and UAS resulted in the loss of the GvpE activation, as did a complete substitution of the proximal 8-nt portion, underlining that a close location of UAS and BRE was very important.

PMID: 18056077 [PubMed - as supplied by publisher]

Stoichiometry and localisation of the stator subunits E and G in T. thermophilus H+ ATPase/synthase.

J Biol Chem. 2007 Nov 30;

Authors: Esteban O, Bernal RA, Donohoe M, Videler H, Sharon M, Robinson CV, Stock D

Proton translocating ATPases are central to biological energy conversion. While eukaryotes contain specialised F-ATPases for ATP synthesis and V-ATPases for proton pumping, eubacteria and archaea typically contain only one enzyme for both tasks. Although many eubacteria contain ATPases of the F-type, some eubacteria and all known archaea contain ATPases of the A-type. A-ATPases are closely related to V-ATPases, but simpler in design. While the nucleotide binding and transmembrane rotor subunits share sequence homology between A-, V- and F-ATPases, the peripheral stalk is strikingly different in sequence, composition and stoichiometry. We have analysed the peripheral stalk of Thermus thermophilus A-ATPase by using phage display derived single-domain antibody fragments in combination with electron microscopy and tandem mass spectrometry. Our data provide the first direct evidence for the existence of two peripheral stalks in the A-ATPase, each one composed of heterodimers of subunits E and G arranged symmetrically around the soluble A1 domain. To our knowledge, this is the first description of phage display-derived antibody selection against a multi-subunit membrane protein used for purification and single particle analysis by electron microscopy. It is also the first instance of the derivation of subunit stoichiometry by tandem mass spectrometry to an intact membrane protein complex. Both approaches could be applicable to the structural analysis of other membrane protein complexes.

PMID: 18055467 [PubMed - as supplied by publisher]

Assessing the evolutionary rate of positional orthologous genes in prokaryotes using synteny data.

BMC Evol Biol. 2007 Nov 29;7(1):237

Authors: Lemoine F, Lespinet O, Labedan B

ABSTRACT: BACKGROUND: Comparison of completely sequenced microbial genomes has revealed how fluid these genomes are. Detecting synteny blocks requires reliable methods to determining the orthologs among the whole set of homologs detected by exhaustive comparisons between each pair of completely sequenced genomes. This is a complex and difficult problem in the field of comparative genomics but will help to better understand the way prokaryotic genomes are evolving. RESULTS: We have developed a suite of programs that automate three essential steps to study conservation of gene order, and validated them with a set of 107 bacteria and archaea that cover the majority of the prokaryotic taxonomic space. We identified the whole set of shared homologs between two or more species and computed the evolutionary distance separating each pair of homologs. We applied two strategies to extract from the set of homologs a collection of valid orthologs shared by at least two genomes. The first computes the Reciprocal Smallest Distance (RSD) using the PAM distances separating pairs of homologs. The second method groups homologs in families and reconstructs each family's evolutionary tree, distinguishing bona fide orthologs as well as paralogs created after the last speciation event. Although the phylogenetic tree method often succeeds where RSD fails, the reverse could occasionally be true. Accordingly, we used the data obtained with either methods or their intersection to number the orthologs that are adjacent in for each pair of genomes, the Positional Orthologous Genes (POGs), and to further study their properties. Once all these synteny blocks have been detected, we showed that POGs are subject to more evolutionary constraints than orthologs outside synteny groups, whichever the taxonomic distance separating the compared organisms. CONCLUSIONS: The suite of programs described in this paper allows a reliable detection of orthologs and is useful for evaluating gene order conservation in prokaryotes whichever their taxonomic distance. Thus, our approach will make easy the rapid identification of POGS in the next few years as we are expecting to be inundated with thousands of completely sequenced microbial genomes.

PMID: 18047665 [PubMed - as supplied by publisher]

Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea.

Biol Direct. 2007 Nov 27;2(1):33

Authors: Makarova KS, Sorokin AV, Novichkov PS, Wolf YI, Koonin EV

ABSTRACT: BACKGROUND: An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs). Rapid accumulation of genome sequences creates opportunities for refining COGs but also represents a challenge because of error amplification. One of the practical strategies involves construction of refined COGs for phylogenetically compact subsets of genomes. RESULTS: New Archaeal Clusters of Orthologous Genes (arCOGs) were constructed for 41 archaeal genomes (13 Crenarchaeota, 27 Euryarchaeota and one Nanoarchaeon) using an improved procedure that employs a similarity tree between smaller, group-specific clusters, semi-automatically partitions orthology domains in multidomain proteins, and uses profile searches for identification of remote orthologs. The annotation of arCOGs is a consensus between three assignments based on the COGs, the CDD database, and the annotations of homologs in the NR database. The 7538 arCOGs, on average, cover ~88% of the genes in a genome compared to a ~76% coverage in COGs. The finer granularity of ortholog identification in the arCOGs is apparent from the fact that 4538 arCOGs correspond to 2362 COGs; ~40% of the arCOGs are new. The archaeal gene core (protein-coding genes found in all 41 genome) consists of 166 arCOGs. The arCOGs were used to reconstruct gene loss and gene gain events during archaeal evolution and gene sets of ancestral forms. The Last Archaeal Common Ancestor (LACA) is conservatively estimated to possess 996 genes compared to 1245 and 1335 genes for the last common ancestors of Crenarchaeota and Euryarchaeota, respectively. It is inferred that LACA was a chemoautotrophic hyperthermophile that, in addition to the core archaeal functions, encoded more idiosyncratic systems, e.g., the CASS systems of antivirus defense and some toxin-antitoxin systems. CONCLUSIONS: The arCOGs provide a convenient, flexible framework for functional annotation of archaeal genomes, comparative genomics and evolutionary reconstructions. These reconstructions suggest that the last common ancestor of archaea was (nearly) as complex as modern archaeal hyperthermophiles. Reviewers: This article was reviewed by Peer Bork, Patrick Forterre, and Purificacion Lopez-Garcia.

PMID: 18042280 [PubMed - as supplied by publisher]

Uracil recognition by replicative DNA polymerases is limited to the archaea, not occurring with bacteria and eukarya.

Nucleic Acids Res. 2007 Nov 21;

Authors: Wardle J, Burgers PM, Cann IK, Darley K, Heslop P, Johansson E, Lin LJ, McGlynn P, Sanvoisin J, Stith CM, Connolly BA

Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.

PMID: 18032433 [PubMed - as supplied by publisher]

Determination of phenylalanine tRNA recognition sites by phenylalanyl-tRNA synthetase from hyperthermophilic archaeon, Aeropyrum pernix K1.

Nucleic Acids Symp Ser (Oxf). 2007;(51):367-8

Authors: Tsuchiya W, Kimura M, Hasegawa T

Phenylalanine tRNA identity has been determined in the bacteria and the eukaryote system, but remains unknown for the archaea system. To investigate the molecular recognition mechanism of phenylalanine tRNA by phenylalanyl-tRNA synthetase from hyperthermophilic and aerobic archaeon, Aeropyrum pernix K1, various mutant transcripts of phenylalanine tRNA prepared by an in vitro transcription system were examined by overexpressed A. pernix phenylalanyl tRNA synthetase. The results indicated that anticodon nucleotides G34, A35 and A36, discriminator base A73 and G20 in the variable pocket were base-specifically recognized by A. pernix phenylalanyl-tRNA synthetase.

PMID: 18029739 [PubMed - in process]

The various strategies of codon decoding in organisms of the three domains of life: evolutionary implications.

Nucleic Acids Symp Ser (Oxf). 2007;(51):15-6

Authors: Grosjean H, Marck C, de Crécy-Lagard V

Over a thousand of cytoplasmic, non organellar tRNA genes were extracted from the whole-genomes of more than 100 organisms spanning the Bacteria, Eukarya and Archaea (tRNomics). Also, whenever possible, the genes coding for modification enzymes acting on tRNA, particularly those involved in modification of nucleotides in the anticodon loop, were identified (Modomics). Combining these two data sets, we were able to reveal three main decoding strategies used by individual contemporary organisms to read the 62 (61+1 initiator) sense codons of mRNA. Based on the known phylogenetic relationships of the different organisms analyzed, this work allows to predict which RNA modification enzymes are essential for an accurate and efficient translation process, as well as to shed light on when these complex and diverse tRNA maturation processes probably emerged during cellular evolution.

PMID: 18029563 [PubMed - in process]

Structure of an archaeal heterotrimeric initiation factor 2 reveals a nucleotide state between the GTP and the GDP states.

Proc Natl Acad Sci U S A. 2007 Nov 20;104(47):18445-50

Authors: Yatime L, Mechulam Y, Blanquet S, Schmitt E

Initiation of translation in eukaryotes and in archaea involves eukaryotic/archaeal initiation factor (e/aIF)1 and the heterotrimeric initiation factor e/aIF2. In its GTP-bound form, e/aIF2 provides the initiation complex with Met-tRNA(i)(Met). After recognition of the start codon by initiator tRNA, e/aIF1 leaves the complex. Finally, e/aIF2, now in a GDP-bound form, loses affinity for Met-tRNA(i)(Met) and dissociates from the ribosome. Here, we report a 3D structure of an aIF2 heterotrimer from the archeon Sulfolobus solfataricus obtained in the presence of GDP. Our report highlights how the two-switch regions involved in formation of the tRNA-binding site on subunit gamma exchange conformational information with alpha and beta. The zinc-binding domain of beta lies close to the guanine nucleotide and directly contacts the switch 1 region. As a result, switch 1 adopts a not yet described conformation. Moreover, unexpectedly for a GDP-bound state, switch 2 has the "ON" conformation. The stability of these conformations is accounted for by a ligand, most probably a phosphate ion, bound near the nucleotide binding site. The structure suggests that this GDP-inorganic phosphate (Pi) bound state of aIF2 may be proficient for tRNA binding. Recently, it has been proposed that dissociation of eIF2 from the initiation complex is closely coupled to that of Pi from eIF2gamma upon start codon recognition. The nucleotide state of aIF2 shown here is indicative of a similar mechanism in archaea. Finally, we consider the possibility that release of Pi takes place after e/aIF2gamma has been informed of e/aIF1 dissociation by e/aIF2beta.

PMID: 18000047 [PubMed - in process]

Genome-wide analysis of growth phase-dependent translational and transcriptional regulation in halophilic archaea.

BMC Genomics. 2007 Nov 12;8(1):415

Authors: Lange C, Zaigler A, Hammelmann M, Twellmeyer J, Raddatz G, Schuster SC, Oesterhelt D, Soppa J

ABSTRACT: BACKGROUND: Differential expression of genes can be regulated on many different levels. Most global studies of gene regulation concentrate on transcript level regulation, and very few global analyses of differential translational efficiencies exist. The studies have revealed that in Saccharomyces cerevisiae, Arabidopsis thaliana, and human cell lines translational regulation plays a significant role. Additional species have not been investigated yet. Particularly, until now no global study of translational control with any prokaryotic species was available. RESULTS: A global analysis of translational control was performed with two haloarchaeal model species, Halobacterium salinarum and Haloferax volcanii. To identify differentially regulated genes, exponentially growing and stationary phase cells were compared. More than 20% of H. salinarum transcripts are translated with non-average efficiencies. By far the largest group is comprised of genes that are translated with above-average efficiency specifically in exponential phase, including genes for many ribosomal proteins, RNA polymerase subunits, enzymes, and chemotaxis proteins. Translation of 1% of all genes is specifically repressed in either of the two growth phases. For comparison, DNA microarrays were also used to identify differential transcriptional regulation in H. salinarum, and 17% of all genes were found to have non-average transcript levels in exponential versus stationary phase. In H. volcanii, 12% of all genes are translated with non-average efficiencies. The overlap with H. salinarum is negligible. In contrast to H. salinarum, 4.6% of genes have non-average translational efficiency in both growth phases, and thus they might be regulated by other stimuli than growth phase. CONCLUSIONS: For the first time in any prokaryotic species it was shown that a significant fraction of genes is under differential translational control. Groups of genes with different regulatory patterns were discovered. However, neither the fractions nor the identity of regulated genes are conserved between H. salinarum and H. volcanii, indicating that prokaryotes as well as eukaryotes use differential translational control for the regulation of gene expression, but that the identity of regulated genes is not conserved For 70 H. salinarum genes potentiation of regulation was observed, but for the majority of regulated genes either transcriptional or translational regulation is employed.

PMID: 17997854 [PubMed - as supplied by publisher]

Sequence analysis of an Archaeal Virus isolated from a hypersaline lake in Inner Mongolia, China.

BMC Genomics. 2007 Nov 9;8(1):410

Authors: Pagaling E, Haigh RD, Grant WD, Cowan DA, Jones BE, Ma Y, Ventosa A, Heaphy S

ABSTRACT: BACKGROUND: We are profoundly ignorant about the diversity of viruses that infect the domain Archaea. Less than 100 have been identified and described and very few of these have had their genomic sequences determined. Here we report the genomic sequence of a previously undescribed archaeal virus. RESULTS: Haloarchaeal strains with 16S rRNA gene sequences 98% identical to Halorubrum saccharovorum were isolated from a hypersaline lake in Inner Mongolia. Two lytic viruses infecting these were isolated from the lake water. The BJ1 virus is described in this paper. It has an icosahedral head and tail morphology and most likely a linear double stranded DNA genome exhibiting terminal redundancy. Its genome sequence has 42,271 base pairs with a GC content of ~65mol%. The genome of BJ1 is predicted to encode 70 ORFs, including one for a tRNA. Fifty of the seventy ORFs had no identity to data base entries; twenty showed sequence identity matches to archaeal viruses and to haloarchaea. ORFs possibly coding for an origin of replication complex, integrase, helicase and structural capsid proteins were identified. Evidence for viral integration was obtained. CONCLUSIONS: The virus described here has a very low sequence identity to any previously described virus. Fifty of the seventy ORFs could not be annotated in any way based on amino acid identities with sequences already present in the databases. Determining functions for ORFs such as these is probably easier using a simple virus as a model system.

PMID: 17996081 [PubMed - as supplied by publisher]

The origins and early evolution of DNA mismatch repair genes multiple horizontal gene transfers and co-evolution.

Nucleic Acids Res. 2007 Oct 26;

Authors: Lin Z, Nei M, Ma H

To understand the evolutionary process of the DNA mismatch repair system, we conducted systematic phylogenetic analysis of its key components, the bacterial MutS and MutL genes and their eukaryotic homologs. Based on genome-wide homolog searches, we identified three new MutS subfamilies (MutS3-5) in addition to the previously studied MutS1 and MutS2 subfamilies. Detailed evolutionary analysis strongly suggests that frequent ancient horizontal gene transfer (HGT) occurred with both MutS and MutL genes from bacteria to eukaryotes and/or archaea. Our results further imply that the origins of mismatch repair system in eukaryotes and archaea are largely attributed to ancient HGT from bacteria instead of vertical evolution. Specifically, the eukaryotic MutS and MutL homologs likely originated from endosymbiotic ancestors of mitochondria or chloroplasts, indicating that not only archaea, but also bacteria are important sources of eukaryotic DNA metabolic genes. The archaeal MutS1 and MutL homologs were also acquired from bacteria simultaneously through HGT. Moreover, the distribution and evolution profiles of the MutS1 and MutL genes suggest that they have undergone long-term coevolution. Our work presents an overall portrait of the evolution of these important genes in DNA metabolism and also provides further understanding about the early evolution of cellular organisms.

PMID: 17965091 [PubMed - as supplied by publisher]

Biochemical characterization of deblocking aminopeptidase from hyperthermophilic archaeon Thermococcus onnurineus NA1.

J Biosci Bioeng. 2007 Sep;104(3):188-94

Authors: Lee HS, Cho Y, Kim YJ, Nam K, Lee JH, Kang SG

A genomic analysis of the hyperthermophilic archaeon Thermoccoccus onnurineus NA1 (TNA1) revealed the presence of a deblocking aminopeptidase (DAP) gene with high similarity to the genes of DAPs from Pyrococcus furiosus (86%) and Pyrococcus horikoshii (83% identity). The optimum aminopeptidase activity of the recombinant enzyme was observed at pH 7.5 and in the range of 90 degrees C to 100 degrees C. The specific aminopeptidase and deblocking activities of the enzyme toward Leu-pNA and Ac-Leu-pNA were 18- and 3-fold higher than those of a P. horikoshii DAP (DAP2), respectively. The enzyme activity was significantly increased by Co(2+) ions. The presence of Co(2+) ions induced the activation of the enzyme with heating and changed the large oligomer to a dimer. The enzyme activated by Co(2+) ions appeared to eventually be inactivated by autodegradation, which was confirmed by mass spectrometry.

PMID: 17964482 [PubMed - indexed for MEDLINE]

Identification of salt-inducible peptide with putative kinase activity in halophilic bacterium Virgibacillus halodenitrificans.

J Biosci Bioeng. 2007 Sep;104(3):178-81

Authors: Rafiee MR, Sokhansanj A, Yoosefi M, Naghizadeh MA

Strain XII, a moderately halophilic bacterium, expressed a peptide in response to saline media. This peptide was designated as salt-inducible factor (Sif-A). The purpose of this study is to describe Sif-A, which might be involved in the osmoresistance mechanism of strain XII. The complete sequence of sif-A was determined using PCR. sif-A codes for a polypeptide of 20.518 kDa. The polypeptide has a putative signal peptide of 27 amino acids (2.667 kDa) preceding the mature protein (17.869 kDa). Motif analysis of the deduced amino acid sequence indicated that there is a p-loop NTPase domain on the C-terminal of the peptide, which might correlate with its function. The sequence of the 16S rRNA gene was analyzed phylogenetically to classify strain XII. This organism was found to have the closest association with Virgibacillus halodenitrificans, which was proven by its phenotypic characteristics.

PMID: 17964480 [PubMed - indexed for MEDLINE]

Microarray Analysis in the Archaeon Halobacterium salinarum Strain R1.

PLoS ONE. 2007;2(10):e1064

Authors: Twellmeyer J, Wende A, Wolfertz J, Pfeiffer F, Panhuysen M, Zaigler A, Soppa J, Welzl G, Oesterhelt D

BACKGROUND: Phototrophy of the extremely halophilic archaeon Halobacterium salinarum was explored for decades. The research was mainly focused on the expression of bacteriorhodopsin and its functional properties. In contrast, less is known about genome wide transcriptional changes and their impact on the physiological adaptation to phototrophy. The tool of choice to record transcriptional profiles is the DNA microarray technique. However, the technique is still rarely used for transcriptome analysis in archaea. METHODOLOGY/PRINCIPAL FINDINGS: We developed a whole-genome DNA microarray based on our sequence data of the Hbt. salinarum strain R1 genome. The potential of our tool is exemplified by the comparison of cells growing under aerobic and phototrophic conditions, respectively. We processed the raw fluorescence data by several stringent filtering steps and a subsequent MAANOVA analysis. The study revealed a lot of transcriptional differences between the two cell states. We found that the transcriptional changes were relatively weak, though significant. Finally, the DNA microarray data were independently verified by a real-time PCR analysis. CONCLUSION/SIGNIFICANCE: This is the first DNA microarray analysis of Hbt. salinarum cells that were actually grown under phototrophic conditions. By comparing the transcriptomics data with current knowledge we could show that our DNA microarray tool is well applicable for transcriptome analysis in the extremely halophilic archaeon Hbt. salinarum. The reliability of our tool is based on both the high-quality array of DNA probes and the stringent data handling including MAANOVA analysis. Among the regulated genes more than 50% had unknown functions. This underlines the fact that haloarchaeal phototrophy is still far away from being completely understood. Hence, the data recorded in this study will be subject to future systems biology analysis.

PMID: 17957248 [PubMed - in process]

A conserved mechanism for replication origin recognition and binding in archaea.

Biochem J. 2007 Oct 23;

Authors: Majerník AI, Chong JP

To date, methanogens are the only group within the Archaea where firing DNA replication origins have not been demonstrated in vivo. Here we show that a previously identified cluster of Origin Recognition Box (ORB) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared to ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3 to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6-ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependant on the interaction of this arginine with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine to a lysine or glutamine. Thus, despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.

PMID: 17956224 [PubMed - as supplied by publisher]

The 3D rRNA modification maps database: with interactive tools for ribosome analysis.

Nucleic Acids Res. 2007 Oct 18;

Authors: Piekna-Przybylska D, Decatur WA, Fournier MJ

The 3D rRNA modification maps database is the first general resource of information about the locations of modified nucleotides within the 3D structure of the full ribosome, with mRNA and tRNAs in the A-, P- and E-sites. The database supports analyses for several model organisms, including higher eukaryotes, and enables users to construct 3D maps for other organisms. Data are provided for human and plant (Arabidopsis) ribosomes, and for other representative organisms from eubacteria, archaea and eukarya. Additionally, the database integrates information about positions of modifications within rRNA sequences and secondary structures, as well as links to other databases and resources about modifications and their biosynthesis. Displaying positions of modified nucleotides is fully manageable. Views of each modified nucleotide are controlled by individual buttons and buttons also control the visibility of different ribosomal molecular components. A section called 'Paint Your Own' enables the user to create a 3D modification map for rRNA from any organism where sites of modification are known. This section also provides capabilities for visualizing nucleotides of interest in rRNA or tRNA, as well as particular amino acids in ribosomal proteins. The database can be accessed at http://people.biochem.umass.edu/fournierlab/3dmodmap/

PMID: 17947322 [PubMed - as supplied by publisher]

SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB.

Nucleic Acids Res. 2007 Oct 24;

Authors: Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies J, Glöckner FO

Sequencing ribosomal RNA (rRNA) genes is currently the method of choice for phylogenetic reconstruction, nucleic acid based detection and quantification of microbial diversity. The ARB software suite with its corresponding rRNA datasets has been accepted by researchers worldwide as a standard tool for large scale rRNA analysis. However, the rapid increase of publicly available rRNA sequence data has recently hampered the maintenance of comprehensive and curated rRNA knowledge databases. A new system, SILVA (from Latin silva, forest), was implemented to provide a central comprehensive web resource for up to date, quality controlled databases of aligned rRNA sequences from the Bacteria, Archaea and Eukarya domains. All sequences are checked for anomalies, carry a rich set of sequence associated contextual information, have multiple taxonomic classifications, and the latest validly described nomenclature. Furthermore, two precompiled sequence datasets compatible with ARB are offered for download on the SILVA website: (i) the reference (Ref) datasets, comprising only high quality, nearly full length sequences suitable for in-depth phylogenetic analysis and probe design and (ii) the comprehensive Parc datasets with all publicly available rRNA sequences longer than 300 nucleotides suitable for biodiversity analyses. The latest publicly available database release 91 (August 2007) hosts 547 521 sequences split into 461 823 small subunit and 85 689 large subunit rRNAs.

PMID: 17947321 [PubMed - as supplied by publisher]

Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial Ser/Thr/Tyr phosphorylation.

Mol Cell Proteomics. 2007 Oct 15;

Authors: Macek B, Gnad F, Soufi B, Kumar C, Olsen JV, Mijakovic I, Mann M

Protein phosphorylation on serine, threonine and tyrosine (Ser/Thr/Tyr) is generally considered the major regulatory posttranslational modification (PTM) in eukaryotic cells. Increasing evidence at the genome and proteome level shows that this modification is also present and functional in prokaryotes. We have recently reported the first in-depth phosphorylation site-resolved dataset from the model Gram-positive bacterium, Bacillus subtilis, showing that Ser/Thr/Tyr phosphorylation is also present on many essential bacterial proteins. To test whether this modification is common in Eubacteria, here we use a recently developed proteomics approach based on phosphopeptide enrichment and high accuracy mass spectrometry to analyze the phosphoproteome of the model Gram-negative bacterium Escherichia coli. We report 81 phosphorylation sites on 79 E. coli proteins, with distribution of Ser/Thr/Tyr phosphorylation sites 68/23/9%. Despite their phylogenetic distance, phosphoproteomes of E. coli and B. subtilis show striking similarity in size, classes of phosphorylated proteins and distribution of Ser/Thr/Tyr phosphorylation sites. By combining the two datasets we created the largest phosphorylation site-resolved database of bacterial phosphoproteins to date (available on www.phosida.com), and used it to study evolutionary conservation of bacterial phosphoproteins and phosphorylation sites across the phylogenetic tree. We demonstrate that bacterial phosphoproteins and phosphorylated residues are significantly more conserved than their non-phosphorylated counterparts, with a number of potential phosphorylation sites conserved from Archaea to humans. Our results establish Ser/Thr/Tyr phosphorylation as a common PTM in Eubacteria, present since the onset of cellular life.

PMID: 17938405 [PubMed - as supplied by publisher]

Characterization of a globin coupled sensor with a gene regulating function.

J Biol Chem. 2007 Oct 9;

Authors: Thijs L, Vinck E, Bolli A, Trandafir F, Wan X, Hoogewijs D, Coletta M, Fago A, Weber RE, Van Doorslaer S, Ascenzi P, Alam M, Moens L, Dewilde S

Globin-coupled sensors (GCSs) are multiple-domain transducers, consisting of a regulatory globin-like heme-binding domain and (a) linked transducer domain(s). GCSs have been described in both Archaea and bacteria. They are generally assumed to bind O2 (and perhaps other gaseous ligands) and to transmit a conformational change signal through the transducer domain in response to fluctuating O2 levels. In this study, the heme-binding domain, AvGReg178, and the full protein, AvGReg of the Azotobacter vinelandii GCS were cloned, expressed and purified. After purification, the heme iron of AvGReg178 was found to bind O2, as revealed by UV-visible and resonance Raman (RR) spectroscopy. This form was stable over many hours. In contrast, electron paramagnetic resonance and UV-visible spectroscopy revealed the predominant presence of a bis-histidine coordinate heme in ferric AvGReg. Differences in the heme pocket structure were also observed for the deoxygenated ferrous state of these proteins. The UV-visible and RR spectra showed that the deoxygenated ferrous derivatives of AvGReg178 and AvGReg are characterized by a penta-coordinate and hexa-coordinate heme iron, respectively. O2 binding isotherms indicate that AvGReg178 and AvGReg show a high affinity for O2 with P50 values at 20 degrees C of 0.04 and 0.15 Torr, respectively. Kinetics of CO binding indicate that AvGReg178 carbonylation conforms to a monophasic process, comparable to that of myoglobin, whereas AvGReg carbonylation conforms to a three-phasic reaction, as observed for several proteins with bis-histidine heme iron coordination. Besides sensing ligands, in vitro data suggest that AvGReg(178) may have a role in O2-mediated NO-detoxification, yielding metAvGReg(178) and nitrate.

PMID: 17925395 [PubMed - as supplied by publisher]

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Nucleic Acids Res. 2007;35(20):6788-97

Authors: Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

PMID: 17921500 [PubMed - in process]

ARC: automated resource classifier for agglomerative functional classification of prokaryotic proteins using annotation texts.

J Biosci. 2007 Aug;32(5):937-45

Authors: Gnanamani M, Kumar N, Ramachandran S

Functional classification of proteins is central to comparative genomics. The need for algorithms tuned to enable integrative interpretation of analytical data is felt globally. The availability of a general,automated software with built-in flexibility will significantly aid this activity. We have prepared ARC (Automated Resource Classifier), which is an open source software meeting the user requirements of flexibility. The default classification scheme based on keyword match is agglomerative and directs entries into any of the 7 basic non-overlapping functional classes: Cell wall, Cell membrane and Transporters (C), Cell division (D), Information (I), Translocation (L), Metabolism (M), Stress(R), Signal and communication (S) and 2 ancillary classes: Others (O) and Hypothetical (H).The keyword library of ARC was built serially by first drawing keywords from Bacillus subtilis and Escherichia coli K12. In subsequent steps,this library was further enriched by collecting terms from archaeal representative Archaeoglobus fulgidus, Gene Ontology, and Gene Symbols. ARC is 94.04% successful on 6,75,663 annotated proteins from 348 prokaryotes. Three examples are provided to illuminate the current perspectives on mycobacterial physiology and costs of proteins in 333 prokaryotes. ARC is available at http://arc.igib.res.in.

PMID: 17914236 [PubMed - indexed for MEDLINE]

Characterization of oligopeptide patterns in large protein sets.

BMC Genomics. 2007 Oct 1;8(1):346

Authors: Bresell A, Persson B

ABSTRACT: BACKGROUND: Recent sequencing projects and the growth of sequence data banks enable oligopeptide patterns to be characterized on a genome or kingdom level. Several studies have focused on kingdom or habitat classifications based on the abundance of short peptide patterns. There have also been efforts at local structural prediction based on short sequence motifs. Oligopeptide patterns undoubtedly carry valuable information content. Therefore, it is important to characterize these informational peptide patterns to shed light on possible new applications and the pitfalls implicit in neglecting bias in peptide patterns. RESULTS: We have studied four classes of pentapeptide patterns (designated POP, NEP, ORP and URP) in the kingdoms archaea, bacteria and eukaryotes. POP are highly abundant patterns statistically not expected to exist; NEP are patterns that do not exist but are statistically expected to; ORP are patterns unique to a kingdom; and URP are patterns excluded from a kingdom. We used two data sources: the de facto standard of protein knowledge Swissprot, and a set of 386 completely sequenced genomes. For each class of peptides we looked at the 100 most extreme and found both known and unknown sequence features. Most of the known sequence motifs can be explained on the basis of the protein families from which they originate. CONCLUSIONS: We find an inherent bias of certain oligopeptide patterns in naturally occurring proteins that cannot be explained solely on the basis of residue distribution in single proteins, kingdoms or databases. We see three predominant categories of patterns: (i) patterns widespread in a kingdom such as those originating from respiratory chain-associated proteins and translation machinery; (ii) proteins with structurally and/or functionally favored patterns, which have not yet been ascribed this role; (iii) multicopy species-specific retrotransposons, only found in the genome set. These categories will affect the accuracy of sequence pattern algorithms that rely mainly on amino acid residue usage. Methods presented in this paper may be used to discover targets for antibiotics, as we identify numerous examples of kingdom-specific antigens among our peptide classes. The methods may also be useful for detecting coding regions of genes.

PMID: 17908308 [PubMed - as supplied by publisher]

Structure, dynamics, and evolution of centromeric nucleosomes.

Proc Natl Acad Sci U S A. 2007 Oct 9;104(41):15974-81

Authors: Dalal Y, Furuyama T, Vermaak D, Henikoff S

Centromeres are defining features of eukaryotic chromosomes, providing sites of attachment for segregation during mitosis and meiosis. The fundamental unit of centromere structure is the centromeric nucleosome, which differs from the conventional nucleosome by the presence of a centromere-specific histone variant (CenH3) in place of canonical H3. We have shown that the CenH3 nucleosome core found in interphase Drosophila cells is a heterotypic tetramer, a "hemisome" consisting of one molecule each of CenH3, H4, H2A, and H2B, rather than the octamer of canonical histones that is found in bulk nucleosomes. The surprising discovery of hemisomes at centromeres calls for a reevaluation of evidence that has long been interpreted in terms of a more conventional nucleosome. We describe how the hemisome structure of centromeric nucleosomes can account for enigmatic properties of centromeres, including kinetochore accessibility, epigenetic inheritance, rapid turnover of misincorporated CenH3, and transcriptional quiescence of pericentric heterochromatin. Structural differences mediated by loop 1 are proposed to account for the formation of stable tetramers containing CenH3 rather than stable octamers containing H3. Asymmetric CenH3 hemisomes might interrupt the global condensation of octameric H3 arrays and present an asymmetric surface for kinetochore formation. We suggest that this simple mechanism for differentiation between centromeric and packaging nucleosomes evolved from an archaea-like ancestor at the dawn of eukaryotic evolution.

PMID: 17893333 [PubMed - indexed for MEDLINE]

Genetic and transcriptomic analysis of transcription factor genes in the model halophilic Archaeon: coordinate action of TbpD and TfbA.

BMC Genet. 2007;8:61

Authors: Coker JA, DasSarma S

BACKGROUND: Archaea are prokaryotic organisms with simplified versions of eukaryotic transcription systems. Genes coding for the general transcription factors TBP and TFB are present in multiple copies in several Archaea, including Halobacterium sp. NRC-1. Multiple TBP and TFBs have been proposed to participate in transcription of genes via recognition and recruitment of RNA polymerase to different classes of promoters. RESULTS: We attempted to knock out all six TBP and seven TFB genes in Halobacterium sp. NRC-1 using the ura3-based gene deletion system. Knockouts were obtained for six out of thirteen genes, tbpCDF and tfbACG, indicating that they are not essential for cell viability under standard conditions. Screening of a population of 1,000 candidate mutants showed that genes which did not yield mutants contained less that 0.1% knockouts, strongly suggesting that they are essential. The transcriptomes of two mutants, Delta tbpD and DeltatfbA, were compared to the parental strain and showed coordinate down regulation of many genes. Over 500 out of 2,677 total genes were regulated in the Delta tbpD and DeltatfbA mutants with 363 regulated in both, indicating that over 10% of genes in both strains require the action of both TbpD and TfbA for normal transcription. Culturing studies on the Delta tbpD and DeltatfbA mutant strains showed them to grow more slowly than the wild-type at an elevated temperature, 49 degrees C, and they showed reduced viability at 56 degrees C, suggesting TbpD and TfbA are involved in the heat shock response. Alignment of TBP and TFB protein sequences suggested the expansion of the TBP gene family, especially in Halobacterium sp. NRC-1, and TFB gene family in representatives of five different genera of haloarchaea in which genome sequences are available. CONCLUSION: Six of thirteen TBP and TFB genes of Halobacterium sp. NRC-1 are non-essential under standard growth conditions. TbpD and TfbA coordinate the expression of over 10% of the genes in the NRC-1 genome. The Delta tbpD and DeltatfbA mutant strains are temperature sensitive, possibly as a result of down regulation of heat shock genes. Sequence alignments suggest the existence of several families of TBP and TFB transcription factors in Halobacterium which may function in transcription of different classes of genes.

PMID: 17892563 [PubMed - indexed for MEDLINE]

The DnaK chaperones from the archaeon Methanosarcina mazei and the bacterium Escherichia coli have different substrate specificities.

Acta Biochim Pol. 2007;54(3):509-22

Authors: Zmijewski MA, Skórko-Glonek J, Tanfani F, Banecki B, Kotlarz A, Macario AJ, Lipińska B

Hsp70 (DnaK) is a highly conserved molecular chaperone present in bacteria, eukaryotes, and some archaea. In a previous work we demonstrated that DnaK from the archaeon Methanosarcina mazei (DnaK(Mm)) and the DnaK from the bacterium Escherichia coli (DnaK(Ec)) were functionally similar when assayed in vitro but DnaK(Mm) failed to substitute for DnaK(Ec) in vivo. Searching for the molecular basis of the observed DnaK species specificity we compared substrate binding by DnaK(Mm) and DnaK(Ec). DnaK(Mm) showed a lower affinity for the model peptide (a-CALLQSRLLS) compared to DnaK(Ec). Furthermore, it was unable to negatively regulate the E. coli sigma(32) transcription factor level under heat shock conditions and poorly bound purified sigma(32), which is a native substrate of DnaK(Ec). These observations taken together indicate differences in substrate specificity of archaeal and bacterial DnaKs. Structural modeling of DnaK(Mm) showed some structural differences in the substrate-binding domains of DnaK(Mm) and DnaK(Ec), which may be responsible, at least partially, for the differences in peptide binding. Size-exclusion chromatography and native gel electrophoresis revealed that DnaK(Mm) was found preferably in high molecular mass oligomeric forms, contrary to DnaK(Ec). Oligomers of DnaK(Mm) could be dissociated in the presence of ATP and a substrate (peptide) but not ADP, which may suggest that monomer is the active form of DnaK(Mm).

PMID: 17882322 [PubMed - in process]

Dynamic interactions within sub-complexes of the H/ACA pseudouridylation guide RNP.

Nucleic Acids Res. 2007;35(18):6196-206

Authors: Youssef OA, Terns RM, Terns MP

H/ACA RNP complexes change uridines to pseudouridines in target non-coding RNAs in eukaryotes and archaea. H/ACA RNPs are comprised of a guide RNA and four essential proteins: Cbf5 (pseudouridine synthase), L7Ae, Gar1 and Nop10 in archaea. The guide RNA captures the target RNA via two antisense elements brought together to form a contiguous binding site within the pseudouridylation pocket (internal loop) of the guide RNA. Cbf5 and L7Ae interact independently with the guide RNA, and here we have examined the impacts of these proteins on the RNA in nucleotide protection assays. The results indicate that the interactions observed in a fully assembled H/ACA RNP are established in the sub-complexes, but also reveal a unique Cbf5-guide RNA interaction that is displaced by L7Ae. In addition, the results indicate that L7Ae binding at the kink (k)-turn of the guide RNA induces the formation of the upper stem, and thus also the pseudouridylation pocket. Our findings indicate that L7Ae is essential for formation of the substrate RNA binding site in the archaeal H/ACA RNP, and suggest that k-turn-binding proteins may remodel partner RNAs with important effects distant from the protein-binding site.

PMID: 17855403 [PubMed - indexed for MEDLINE]

The role of gene fusions in the evolution of metabolic pathways: the histidine biosynthesis case.

BMC Evol Biol. 2007;7 Suppl 2:S4

Authors: Fani R, Brilli M, Fondi M, Lió P

BACKGROUND: Histidine biosynthesis is one of the best characterized anabolic pathways. There is a large body of genetic and biochemical information available, including operon structure, gene expression, and increasingly larger sequence databases. For over forty years this pathway has been the subject of extensive studies, mainly in Escherichia coli and Salmonella enterica, in both of which details of histidine biosynthesis appear to be identical. In these two enterobacteria the pathway is unbranched, includes a number of unusual reactions, and consists of nine intermediates; his genes are arranged in a compact operon (hisGDC [NB]HAF [IE]), with three of them (hisNB, hisD and hisIE) coding for bifunctional enzymes. We performed a detailed analysis of his gene fusions in available genomes to understand the role of gene fusions in shaping this pathway. RESULTS: The analysis of HisA structures revealed that several gene elongation events are at the root of this protein family: internal duplication have been identified by structural superposition of the modules composing the TIM-barrel protein. Several his gene fusions happened in distinct taxonomic lineages; hisNB originated within gamma-proteobacteria and after its appearance it was transferred to Campylobacter species (epsilon-proteobacteria) and to some Bacteria belonging to the CFB group. The transfer involved the entire his operon. The hisIE gene fusion was found in several taxonomic lineages and our results suggest that it probably happened several times in distinct lineages. Gene fusions involving hisIE and hisD genes (HIS4) and hisH and hisF genes (HIS7) took place in the Eukarya domain; the latter has been transferred to some delta-proteobacteria. CONCLUSION: Gene duplication is the most widely known mechanism responsible for the origin and evolution of metabolic pathways; however, several other mechanisms might concur in the process of pathway assembly and gene fusion appeared to be one of the most important and common.

PMID: 17767732 [PubMed - indexed for MEDLINE]

The primordial metabolism: an ancestral interconnection between leucine, arginine, and lysine biosynthesis.

BMC Evol Biol. 2007;7 Suppl 2:S3

Authors: Fondi M, Brilli M, Emiliani G, Paffetti D, Fani R

BACKGROUND: It is generally assumed that primordial cells had small genomes with simple genes coding for enzymes able to react with a wide range of chemically related substrates, interconnecting different metabolic routes. New genes coding for enzymes with a narrowed substrate specificity arose by paralogous duplication(s) of ancestral ones and evolutionary divergence. In this way new metabolic pathways were built up by primordial cells. Useful hints to disclose the origin and evolution of ancestral metabolic routes and their interconnections can be obtained by comparing sequences of enzymes involved in the same or different metabolic routes. From this viewpoint, the lysine, arginine, and leucine biosynthetic routes represent very interesting study-models. Some of the lys, arg and leu genes are paralogs; this led to the suggestion that their ancestor genes might interconnect the three pathways. The aim of this work was to trace the evolutionary pathway leading to the appearance of the extant biosynthetic routes and to try to disclose the interrelationships existing between them and other pathways in the early stages of cellular evolution. RESULTS: The comparative analysis of the genes involved in the biosynthesis of lysine, leucine, and arginine, their phylogenetic distribution and analysis revealed that the extant metabolic "grids" and their interrelationships might be the outcome of a cascade of duplication of ancestral genes that, according to the patchwork hypothesis, coded for unspecific enzymes able to react with a wide range of substrates. These genes belonged to a single common pathway in which the three biosynthetic routes were highly interconnected between them and also to methionine, threonine, and cell wall biosynthesis. A possible evolutionary model leading to the extant metabolic scenarios was also depicted. CONCLUSION: The whole body of data obtained in this work suggests that primordial cells synthesized leucine, lysine, and arginine through a single common metabolic pathway, whose genes underwent a set of duplication events, most of which can have predated the appearance of the last common universal ancestor of the three cell domains (Archaea, Bacteria, and Eucaryotes). The model proposes a relative timing for the appearance of the three routes and also suggests a possible evolutionary pathway for the assembly of bacterial cell-wall.

PMID: 17767731 [PubMed - indexed for MEDLINE]

An aminoacyl-tRNA synthetase:elongation factor complex for substrate channeling in archaeal translation.

Nucleic Acids Res. 2007;35(18):6094-102

Authors: Hausmann CD, Praetorius-Ibba M, Ibba M

Translation requires the specific attachment of amino acids to tRNAs by aminoacyl-tRNA synthetases (aaRSs) and the subsequent delivery of aminoacyl-tRNAs to the ribosome by elongation factor 1 alpha (EF-1alpha). Interactions between EF-1alpha and various aaRSs have been described in eukaryotes, but the role of these complexes remains unclear. To investigate possible interactions between EF-1alpha and other cellular components, a yeast two-hybrid screen was performed for the archaeon Methanothermobacter thermautotrophicus. EF-1alpha was found to form a stable complex with leucyl-tRNA synthetase (LeuRS; K(D) = 0.7 microM). Complex formation had little effect on EF-1alpha activity, but increased the k(cat) for Leu-tRNA(Leu) synthesis approximately 8-fold. In addition, EF-1alpha co-purified with the archaeal multi-synthetase complex (MSC) comprised of LeuRS, LysRS and ProRS, suggesting the existence of a larger aaRS:EF-1alpha complex in archaea. These interactions between EF-1alpha and the archaeal MSC contribute to translational fidelity both by enhancing the aminoacylation efficiencies of the three aaRSs in the complex and by coupling two stages of translation: aminoacylation of cognate tRNAs and their subsequent channeling to the ribosome.

PMID: 17766929 [PubMed - indexed for MEDLINE]

An archaeal orthologue of the universal protein Kae1 is an iron metalloprotein which exhibits atypical DNA-binding properties and apurinic-endonuclease activity in vitro.

Nucleic Acids Res. 2007;35(18):6042-51

Authors: Hecker A, Leulliot N, Gadelle D, Graille M, Justome A, Dorlet P, Brochier C, Quevillon-Cheruel S, Le Cam E, van Tilbeurgh H, Forterre P

The Kae1 (Kinase-associated endopeptidase 1) protein is a member of the recently identified transcription complex EKC and telomeres maintenance complex KEOPS in yeast. Kae1 homologues are encoded by all sequenced genomes in the three domains of life. Although annotated as putative endopeptidases, the actual functions of these universal proteins are unknown. Here we show that the purified Kae1 protein (Pa-Kae1) from Pyrococcus abyssi is an iron-protein with a novel type of ATP-binding site. Surprisingly, this protein did not exhibit endopeptidase activity in vitro but binds cooperatively to single and double-stranded DNA and induces unusual DNA conformational change. Furthermore, Pa-Kae1 exhibits a class I apurinic (AP)-endonuclease activity (AP-lyase). Both DNA binding and AP-endonuclease activity are inhibited by ATP. Kae1 is thus a novel and atypical universal DNA interacting protein whose importance could rival those of RecA (RadA/Rad51) in the maintenance of genome integrity in all living cells.

PMID: 17766251 [PubMed - indexed for MEDLINE]

Glycerate kinase of the hyperthermophilic archaeon Thermoproteus tenax: new insights into the phylogenetic distribution and physiological role of members of the three different glycerate kinase classes.

BMC Genomics. 2007;8:301

Authors: Kehrer D, Ahmed H, Brinkmann H, Siebers B

BACKGROUND: The presence of the branched Entner-Doudoroff (ED) pathway in two hyperthermophilic Crenarchaea, the anaerobe Thermoproteus tenax and the aerobe Sulfolobus solfataricus, was suggested. However, so far no enzymatic information of the non-phosphorylative ED branch and especially its key enzyme - glycerate kinase - was available. In the T. tenax genome, a gene homolog with similarity to putative hydroxypyruvate reductase/glycerate dehydrogenase and glycerate kinase was identified. RESULTS: The encoding gene was expressed in E. coli in a recombinant form, the gene product purified and the glycerate kinase activity was confirmed by enzymatic studies. The enzyme was active as a monomer and catalyzed the ATP-dependent phosphorylation of D-glycerate forming exclusively 2-phosphoglycerate. The enzyme was specific for glycerate and highest activity was observed with ATP as phosphoryl donor and Mg2+ as divalent cation. ATP could be partially replaced by GTP, CTP, TTP and UTP. The enzyme showed high affinity for D-glycerate (Km 0.02 +/- 0.01 mM, Vmax of 5.05 +/- 0.52 U/mg protein) as well as ATP (Km of 0.03 +/- 0.01 mM, Vmax of 4.41 +/- 0.04 U/mg protein), although at higher glycerate concentrations, substrate inhibition was observed. Furthermore, the enzyme was inhibited by its product ADP via competitive inhibition. Data bank searches revealed that archaeal glycerate kinases are members of the MOFRL (multi-organism fragment with rich leucine) family, and homologs are found in all three domains of life. CONCLUSION: A re-evaluation of available genome sequence information as well as biochemical and phylogenetic studies revealed the presence of the branched ED pathway as common route for sugar degradation in Archaea that utilize the ED pathway. Detailed analyses including phylogenetic studies demonstrate the presence of three distinct glycerate kinase classes in extant organisms that share no common origin. The affiliation of characterized glycerate kinases with the different enzyme classes as well as their physiological/cellular function reveals no association with particular pathways but a separate phylogenetic distribution. This work highlights the diversity and complexity of the central carbohydrate metabolism. The data also support a key function of the conversion of glycerate to 2- or 3-phosphoglycerate via glycerate kinase in funneling various substrates into the common EMP pathway for catabolic and anabolic purposes.

PMID: 17764545 [PubMed - in process]

Molecular basis of Diamond-Blackfan anemia: structure and function analysis of RPS19.

Nucleic Acids Res. 2007;35(17):5913-21

Authors: Gregory LA, Aguissa-Touré AH, Pinaud N, Legrand P, Gleizes PE, Fribourg S

Diamond-Blackfan anemia (DBA) is a rare congenital disease linked to mutations in the ribosomal protein genes rps19, rps24 and rps17. It belongs to the emerging class of ribosomal disorders. To understand the impact of DBA mutations on RPS19 function, we have solved the crystal structure of RPS19 from Pyrococcus abyssi. The protein forms a five alpha-helix bundle organized around a central amphipathic alpha-helix, which corresponds to the DBA mutation hot spot. From the structure, we classify DBA mutations relative to their respective impact on protein folding (class I) or on surface properties (class II). Class II mutations cluster into two conserved basic patches. In vivo analysis in yeast demonstrates an essential role for class II residues in the incorporation into pre-40S ribosomal particles. This data indicate that missense mutations in DBA primarily affect the capacity of the protein to be incorporated into pre-ribosomes, thus blocking maturation of the pre-40S particles.

PMID: 17726054 [PubMed - indexed for MEDLINE]

Correlation between structure and temperature in prokaryotic metabolic networks.

BMC Bioinformatics. 2007;8:303

Authors: Takemoto K, Nacher JC, Akutsu T

BACKGROUND: In recent years, an extensive characterization of network structures has been made in an effort to elucidate design principles of metabolic networks, providing valuable insights into the functional organization and the evolutionary history of organisms. However, previous analyses have not discussed the effects of environmental factors (i.e., exogenous forces) in shaping network structures. In this work, we investigate the effect of temperature, which is one of the environmental factors that may have contributed to shaping structures of metabolic networks. RESULTS: For this, we investigate the correlations between several structural properties characterized by graph metrics like the edge density, the degree exponent, the clustering coefficient, and the subgraph concentration in the metabolic networks of 113 prokaryotes and optimal growth temperature. As a result, we find that these structural properties are correlated with the optimal growth temperature. With increasing temperature, the edge density, the clustering coefficient and the subgraph concentration decrease and the degree exponent becomes large. CONCLUSION: This result implies that the metabolic networks transit with temperature as follows. The density of chemical reactions becomes low, the connectivity of the networks becomes homogeneous such as random networks and both the network modularity, based on the graph-theoretic clustering coefficient, and the frequency of recurring subgraphs decay. In short, metabolic networks undergo a change from heterogeneous and high-modular structures to homogeneous and low-modular structures, such as random networks, with temperature. This finding may suggest that the temperature plays an important role in the design principles of metabolic networks.

PMID: 17711568 [PubMed - indexed for MEDLINE]

Properties of an unusual DNA primase from an archaeal plasmid.

Nucleic Acids Res. 2007;35(17):5635-45

Authors: Beck K, Lipps G

Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5' end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5' to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer.

PMID: 17709343 [PubMed - indexed for MEDLINE]

The Biological Big Bang model for the major transitions in evolution.

Biol Direct. 2007;2:21

Authors: Koonin EV

ABSTRACT: BACKGROUND: Major transitions in biological evolution show the same pattern of sudden emergence of diverse forms at a new level of complexity. The relationships between major groups within an emergent new class of biological entities are hard to decipher and do not seem to fit the tree pattern that, following Darwin's original proposal, remains the dominant description of biological evolution. The cases in point include the origin of complex RNA molecules and protein folds; major groups of viruses; archaea and bacteria, and the principal lineages within each of these prokaryotic domains; eukaryotic supergroups; and animal phyla. In each of these pivotal nexuses in life's history, the principal "types" seem to appear rapidly and fully equipped with the signature features of the respective new level of biological organization. No intermediate "grades" or intermediate forms between different types are detectable. Usually, this pattern is attributed to cladogenesis compressed in time, combined with the inevitable erosion of the phylogenetic signal. HYPOTHESIS: I propose that most or all major evolutionary transitions that show the "explosive" pattern of emergence of new types of biological entities correspond to a boundary between two qualitatively distinct evolutionary phases. The first, inflationary phase is characterized by extremely rapid evolution driven by various processes of genetic information exchange, such as horizontal gene transfer, recombination, fusion, fission, and spread of mobile elements. These processes give rise to a vast diversity of forms from which the main classes of entities at the new level of complexity emerge independently, through a sampling process. In the second phase, evolution dramatically slows down, the respective process of genetic information exchange tapers off, and multiple lineages of the new type of entities emerge, each of them evolving in a tree-like fashion from that point on. This biphasic model of evolution incorporates the previously developed concepts of the emergence of protein folds by recombination of small structural units and origin of viruses and cells from a pre-cellular compartmentalized pool of recombining genetic elements. The model is extended to encompass other major transitions. It is proposed that bacterial and archaeal phyla emerged independently from two distinct populations of primordial cells that, originally, possessed leaky membranes, which made the cells prone to rampant gene exchange; and that the eukaryotic supergroups emerged through distinct, secondary endosymbiotic events (as opposed to the primary, mitochondrial endosymbiosis). This biphasic model of evolution is substantially analogous to the scenario of the origin of universes in the eternal inflation version of modern cosmology. Under this model, universes like ours emerge in the infinite multiverse when the eternal process of exponential expansion, known as inflation, ceases in a particular region as a result of false vacuum decay, a first order phase transition process. The result is the nucleation of a new universe, which is traditionally denoted Big Bang, although this scenario is radically different from the Big Bang of the traditional model of an expanding universe. Hence I denote the phase transitions at the end of each inflationary epoch in the history of life Biological Big Bangs (BBB). CONCLUSION: A Biological Big Bang (BBB) model is proposed for the major transitions in life's evolution. According to this model, each transition is a BBB such that new classes of biological entities emerge at the end of a rapid phase of evolution (inflation) that is characterized by extensive exchange of genetic information which takes distinct forms for different BBBs. The major types of new forms emerge independently, via a sampling process, from the pool of recombining entities of the preceding generation. This process is envisaged as being qualitatively different from tree-pattern cladogenesis. REVIEWERS: This article was reviewed by William Martin, Sergei Maslov, and Leonid Mirny.

PMID: 17708768 [PubMed - in process]

Identification of determinants in the protein partners aCBF5 and aNOP10 necessary for the tRNA:Psi55-synthase and RNA-guided RNA:Psi-synthase activities.

Nucleic Acids Res. 2007;35(16):5610-24

Authors: Muller S, Fourmann JB, Loegler C, Charpentier B, Branlant C

Protein aNOP10 has an essential scaffolding function in H/ACA sRNPs and its interaction with the pseudouridine(Psi)-synthase aCBF5 is required for the RNA-guided RNA:Psi-synthase activity. Recently, aCBF5 was shown to catalyze the isomerization of U55 in tRNAs without the help of a guide sRNA. Here we show that the stable anchoring of aCBF5 to tRNAs relies on its PUA domain and the tRNA CCA sequence. Nonetheless, interaction of aNOP10 with aCBF5 can counterbalance the absence of the PUA domain or the CCA sequence and more generally helps the aCBF5 tRNA:Psi55-synthase activity. Whereas substitution of the aNOP10 residue Y14 by an alanine disturbs this activity, it only impairs mildly the RNA-guided activity. The opposite effect was observed for the aNOP10 variant H31A. Substitution K53A or R202A in aCBF5 impairs both the tRNA:Psi55-synthase and the RNA-guided RNA:Psi-synthase activities. Remarkably, the presence of aNOP10 compensates for the negative effect of these substitutions on the tRNA: Psi55-synthase activity. Substitution of the aCBF5 conserved residue H77 that is expected to extrude the targeted U residue in tRNA strongly affects the efficiency of U55 modification but has no major effect on the RNA-guided activity. This negative effect can also be compensated by the presence of aNOP10.

PMID: 17704128 [PubMed - indexed for MEDLINE]

Effects of divalent cations on Halobacterium salinarum cell aggregation.

J Biosci Bioeng. 2007 Jul;104(1):42-6

Authors: Kawakami Y, Hayashi N, Ema M, Nakayama M

Ca(2+) was found to be essential for initiating Halobacterium salinarum CCM 2090 cell aggregation. The floc formed from such aggregation could easily be dissociated without cellular lysis by sodium citrate. Cr(2+), Mn(2+), Fe(3+), Co(2+), Ni(2+), Cu(2+), and Zn(2+) could replace Ca(2+). However, Mg(2+), Sr(2+), Mo(2+), Cd(2+), Sn(2+), Hg(2+), and Pb(2+) induced no flocculation of cells of this halophilic archaeon. Mg(2+) acted antagonistically against Ca(2+)-induced aggregation. Such aggregation might be directly caused by the interaction of Ca(2+) and aggregation factors from 55 degrees C-treated cell extract.

PMID: 17697982 [PubMed - indexed for MEDLINE]

Redox stress proteins are involved in adaptation response of the hyperthermoacidophilic archaeon Sulfolobus solfataricus to nickel challenge.

Microb Cell Fact. 2007;6:25

Authors: Salzano AM, Febbraio F, Farias T, Cetrangolo GP, Nucci R, Scaloni A, Manco G

ABSTRACT: BACKGROUND: Exposure to nickel (Ni) and its chemical derivatives has been associated with severe health effects in human. On the contrary, poor knowledge has been acquired on target physiological processes or molecular mechanisms of this metal in model organisms, including Bacteria and Archaea. In this study, we describe an analysis focused at identifying proteins involved in the recovery of the archaeon Sulfolobus solfataricus strain MT4 from Ni-induced stress. RESULTS: To this purpose, Sulfolobus solfataricus was grown in the presence of the highest nickel sulphate concentration still allowing cells to survive; crude extracts from treated and untreated cells were compared at the proteome level by using a bi-dimensional chromatography approach. We identified several proteins specifically repressed or induced as result of Ni treatment. Observed up-regulated proteins were largely endowed with the ability to trigger recovery from oxidative and osmotic stress in other biological systems. It is noteworthy that most of the proteins induced following Ni treatment perform similar functions and a few have eukaryal homologue counterparts. CONCLUSION: These findings suggest a series of preferential gene expression pathways activated in adaptation response to metal challenge.

PMID: 17692131 [PubMed - in process]

Novel heroin injection practices: implications for transmission of HIV and other bloodborne pathogens.

Am J Prev Med. 2007 Jun;32(6 Suppl):S226-33

Authors: Clatts MC, Giang le M, Goldsamt LA, Yi H

BACKGROUND: This paper describes injection risk in an out-of-treatment population of young heroin users in Hanoi, Vietnam, including use of a soft-tissue portal known as a "cay ma" (injection sac). METHODS: Data from a large cross-sectional survey (N=1270) are used to describe the prevalence of this practice and its association with disease. Additionally, data from an ethnographic substudy on injectors serve to elaborate injectors' rationales for this injection practice. RESULTS: This practice was common in this sample, appearing soon after initiation of habitual injection. Injectors report that this allows rapid and reliable access to a vein; strategic advantages in a dense urban environment where rapid injection, typically in public settings, is necessary to avoid discovery or arrest. Additionally, this practice is believed to mitigate risk for vein damage from co-morbid promethazine hydrochloride injection. CONCLUSIONS: This practice may draw lymphocytes to injection sites, thereby increasing risk for transmission of bloodborne pathogens. Structural and behavioral interventions are needed for young heroin users in Vietnam.

PMID: 17543715 [PubMed - indexed for MEDLINE]

Accidental exposure to blood in medical interns of Tehran University of Medical Sciences.

J Occup Health. 2007 Jul;49(4):317-21

Authors: Shariati B, Shahidzadeh-Mahani A, Oveysi T, Akhlaghi H

Healthcare workers and medical students are at risk of exposure to blood-borne viruses such as HBV, HCV HIV, etc. Here we report the results of a survey of the frequency and causes of cutaneous blood exposure accidents (CBEA) among medical students. Anonymous questionnaires were randomly distributed to 200 interns in their second year of internship in hospitals affiliated to Tehran University of Medical Sciences. A definite exposure was defined as injury by a sharp object causing obvious bleeding, whereas a possible exposure was defined as subtle or superficial injury due to contact with a contaminated instrument or needle but without bleeding, or contamination of an existing wound with blood or other body fluids. One hundred eighty-four subjects (92% of the original sample) responded to the questionnaire. We recorded 121 definite exposures and 259 possible exposures over a mean time interval of 14 months. Needles were the most common objects (41% of exposure episodes) causing CBEAs, while phlebotomy and suturing were the hospital procedures that accounted for the highest percentage of exposure episodes (30 and 28 percent, respectively). Only a minority of students regularly observed basic safety measures (wearing gloves, not recapping used needles and proper disposal of sharp objects). Considering the high incidence of blood exposure in medical interns at Tehran University of Medical Sciences and the ensuing risk of blood-borne infections, the subjects are likely to develop such infections during their internship period.

PMID: 17690526 [PubMed - indexed for MEDLINE]

Canadian Blood Services to screen for Chagas disease.

CMAJ. 2007 Jul 31;177(3):242

Authors: Comeau P

PMID: 17664439 [PubMed - indexed for MEDLINE]

Prevalence of injections and knowledge of safe injections among rural residents in Central China.

Singapore Med J. 2007 Aug;48(8):769-74

Authors: Yan YW, Yan J, Zhang GP, Gao ZL, Jian HX

INTRODUCTION: Abuse of the injection services, namely unnecessary injections and unsafe injections, exists extensively in developing countries. Unsafe injection practices contribute to the transmission of blood-borne pathogens. The aims of this study were to survey the prevalence of injections and knowledge of injection safety among the rural residents in Jingzhou district, Hubei, China and to provide scientific data for developing a health educational programme. METHODS: A retrospective cross-sectional study was conducted in 12 villages, which were selected from the Jingzhou district by the random sampling method. 50 rural residents were interviewed per village using a questionnaire. RESULTS: Among the 595 residents studied, 192 had received at least one injection in the past three months, with an injection prevalence of 32.3 percent and an average of 0.93 injections. 90.3 percent of the rural residents knew that unsafe injections could transmit the following blood-borne pathogens: human immunodeficiency virus (74.4 percent), hepatitis B virus (55.8 percent) and hepatitis C virus (22.9 percent). Logistic regression analysis showed that the residents' age, educational level and residential area were important factors in influencing their knowledge about injection safety. CONCLUSION: The results indicated that the injection prevalence was high among rural residents in the study area, and their knowledge regarding injection safety should be further improved.

PMID: 17657388 [PubMed - indexed for MEDLINE]

Isolation and characterization of cultivable fermentative bacteria from the intestine of two edible snails, Helixpomatia and Cornu aspersum (Gastropoda: Pulmonata).

Biol Res. 2006;39(4):669-81

Authors: Charrier M, Fonty G, Gaillard-Martinie B, Ainouche K, Andant G

The intestinal microbiota of the edible snails Cornu aspersum fSyn: H. aspersa), and Helix pomatia were investigated by culture-based methods, 16S rRNA sequence analyses and phenotypic characterisations. The study was carried out on aestivating snails and two populations of H. pomatia were considered. The cultivable bacteria dominated in the distal part of the intestine, with up to 5.10(9) CFU g -1, but the Swedish H. pomatia appeared significantly less colonised, suggesting a higher sensitivity of its microbiota to climatic change. All the strains, but one, shared >/= 97% sequence identity with reference strains. They were arranged into two taxa: the Gamma Proteobacteria with Buttiauxella, Citrobacter, Enterobacter, Kluyvera, Obesumbacterium, Raoultella and the Firmicutes with Enterococcus, Lactococcus, and Clostridium. According to the literature, these genera are mostly assigned to enteric environments or to phyllosphere, data in favour of culturing snails in contact with soil and plants. None of the strains were able to digest filter paper, Avicel cellulose or carboxymethyl cellulose (CMC). Acetogens and methanogenic archaea were not cultivated, so the fate of hydrogen remains questionable. This microbiota could play important roles in the digestive process (fermentation) and the energy supply of the snail (L-lactate, acetate). The choice of cereals and plants by snail farmers should take into account the fermentative abilities of the intestinal microbiota.

PMID: 17657348 [PubMed - in process]

Transcriptional profiling of the model Archaeon Halobacterium sp. NRC-1: responses to changes in salinity and temperature.

Saline Systems. 2007;3:6

Authors: Coker JA, Dassarma P, Kumar J, Müller JA, Dassarma S

ABSTRACT: BACKGROUND: The model halophile Halobacterium sp. NRC-1 was among the first Archaea to be completely sequenced and many post-genomic tools, including whole genome DNA microarrays are now being applied to its analysis. This extremophile displays tolerance to multiple stresses, including high salinity, extreme (non-mesophilic) temperatures, lack of oxygen, and ultraviolet and ionizing radiation. RESULTS: In order to study the response of Halobacterium sp. NRC-1 to two common stressors, salinity and temperature, we used whole genome DNA microarrays to assay for changes in gene expression under differential growth conditions. Cultures grown aerobically in rich medium at 42 degrees C were compared to cultures grown at elevated or reduced temperature and high or low salinity. The results obtained were analyzed using a custom database and microarray analysis tools. Growth under salt stress conditions resulted in the modulation of genes coding for many ion transporters, including potassium, phosphate, and iron transporters, as well as some peptide transporters and stress proteins. Growth at cold temperature altered the expression of genes involved in lipid metabolism, buoyant gas vesicles, and cold shock proteins. Heat shock showed induction of several known chaperone genes. The results showed that Halobacterium sp. NRC-1 cells are highly responsive to environmental changes at the level of gene expression. CONCLUSION: Transcriptional profiling showed that Halobacterium sp. NRC-1 is highly responsive to its environment and provided insights into some of the specific responses at the level of gene expression. Responses to changes in salt conditions appear to be designed to minimize the loss of essential ionic species and abate possible toxic effects of others, while exposure to temperature extremes elicit responses to promote protein folding and limit factors responsible for growth inhibition. This work lays the foundation for further bioinformatic and genetic studies which will lead to a more comprehensive understanding of the biology of a model halophilic Archaeon.

PMID: 17651475 [PubMed - in process]

Poor knowledge--predictor of nonadherence to universal precautions for blood borne pathogens at first level care facilities in Pakistan.

BMC Infect Dis. 2007;7:81

Authors: Janjua NZ, Razaq M, Chandir S, Rozi S, Mahmood B

BACKGROUND: We conducted an assessment of knowledge about blood borne pathogens (BBP) and use of universal precautions at first level care facilities (FLCF) in two districts of Pakistan. METHODS: We conducted a cross-sectional survey and selected three different types of FLCFs ; public, general practitioners and unqualified practitioners through stratified random sampling technique. At each facility, we interviewed a prescriber, a dispenser, and a housekeeper for knowledge of BBPs transmission and preventive practices, risk perception, and use of universal precautions. We performed multiple linear regression to assess the effect of knowledge score (11 items) on the practice of universal precautions score (4 items- use of gloves, gown, needle recapping, and HBV vaccination). RESULTS: We interviewed 239 subjects. Most of the participants 128 (53%) were recruited from general practitioners clinics and 166 (69.5%) of them were dispensers. Mean (SD) knowledge score was 3.8 (2.3) with median of 4. MBBS prescribers had the highest knowledge score while the housekeepers had the lowest. Mean universal precautions use score was 2.7 +/- 2.1. Knowledge about mode of transmission and the work experience alone, significantly predicted universal precaution use in multiple linear regression model (adR2 = 0.093). CONCLUSION: Knowledge about mode of transmission of blood borne pathogens is very low. Use of universal precautions can improve with increase in knowledge.

PMID: 17650331 [PubMed - indexed for MEDLINE]

Genomics against flatulence.

Environ Microbiol. 2007 Aug;9(8):1869-77

Authors: Galperin MY

PMID: 17635535 [PubMed - indexed for MEDLINE]

Putative prophages related to lytic tailless marine dsDNA phage PM2 are widespread in the genomes of aquatic bacteria.

BMC Genomics. 2007;8:236

Authors: Krupovic M, Bamford DH

BACKGROUND: The origin and evolution of viruses is currently a heavily discussed issue. One element in this discussion is the innate viral "self" concept, which suggests that viral structures and functions can be divided into two categories. The first category consists of genetic determinants that are inherited from a viral ancestor and encode the viral "self". The second group consists of another set of structures and functions, the "nonself", which is interchangeable between different viruses and can be obtained via lateral gene transfer. Comparing the structures and sequences of the "self" elements, we have proposed that viruses can be grouped into lineages regardless of which domain of life (bacteria, archaea, eukarya) they infect. It has also been suggested that viruses are ancient and possibly predate modern cells. RESULTS: Here we identified thirteen putative prophages (viral genomes integrated into bacterial chromosome) closely related to the virulent icosahedral tailless lipid-containing bacteriophage PM2. Using the comparative genomics approach, we present evidence to support the viral "self" hypothesis and divide genes of the bacteriophage PM2 and related prophages into "self" and "nonself" categories. CONCLUSION: We show here that the previously proposed most conserved viral "self" determinants, the major coat protein and the packaging ATPase, were the only proteins that could be recognized in all detected corticoviral elements. We also argue here that the genes needed for viral genome replication, as well as for host cell lysis, belong to the "nonself" category of genes.Furthermore, we suggest that abundance of PM2-like viruses in the aquatic environment as well as their importance in the ecology of aquatic microorganisms might have been underestimated.

PMID: 17634101 [PubMed - indexed for MEDLINE]

OSHA is not a city in Wisconsin.

Am J Pharm Educ. 2007 Jun 15;71(3):55

Authors: Flaherty DK

PMID: 17619655 [PubMed - indexed for MEDLINE]

(NZ)CH...O contacts assist crystallization of a ParB-like nuclease.

BMC Struct Biol. 2007;7:46

Authors: Shaw N, Cheng C, Tempel W, Chang J, Ng J, Wang XY, Perrett S, Rose J, Rao Z, Wang BC, Liu ZJ

BACKGROUND: The major bottleneck for determination of 3 D structures of proteins using X-rays is the production of diffraction quality crystals. Often proteins are subjected to chemical modification to improve the chances of crystallization RESULTS: Here, we report the successful crystallization of a nuclease employing a reductive methylation protocol. The key to crystallization was the successful introduction of 44 new cohesive (NZ) CH...O contacts (3.2-3.7 A) by the addition of 2 methyl groups to the side chain amine nitrogen (NZ) of 9 lysine residues of the nuclease. The new contacts dramatically altered the crystallization properties of the protein, resulting in crystals that diffracted to 1.2 A resolution. Analytical ultracentrifugation analysis and thermodynamics results revealed a more compact protein structure with better solvent exclusion of buried Trp residues in the folded state of the methylated protein, assisting crystallization. CONCLUSION: In this study, introduction of novel cohesive (NZ)CH...O contacts by reductive methylation resulted in the crystallization of a protein that had previously resisted crystallization in spite of extensive purification and crystallization space screening. Introduction of (NZ)CH...O contacts could provide a solution to crystallization problems for a broad range of protein targets.

PMID: 17617922 [PubMed - indexed for MEDLINE]